Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04537 |
---|---|
Accession No | AB007949 |
Description | centrosomal protein 350kDa |
Clone name | hh00807 |
Vector information | |
cDNA sequence | DNA sequence (6111 bp) Predicted protein sequence (1288 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0480
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000938 | 670 | 735 | PF01302 | CAP-Gly |
ProfileScan | IPR000938 | 688 | 730 | PS50245 | CAP-Gly |
ScanRegExp | IPR000938 | 688 | 719 | PS00845 | CAP-Gly |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGAAAAACAACCTACAGTCCC |
Primer_r | TGTTTGTAGGATCACGTTGTC |
PCR product length | 107 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |