Gene/Protein Characteristic Table for KIAA0480
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04537
Accession No AB007949
Description centrosomal protein 350kDa
Clone name hh00807
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6111 bp)
Predicted protein sequence (1288 aa)
Source Human adult brain
Rouge ID mKIAA0480 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1288 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI14834 0 99.8 centrosomal pro...
Homo sapiens
AAL55733 0 98.6 centrosome-asso...
Homo sapiens
EAW91070 0 98.5 centrosomal pro...
Homo sapiens
Q5VT06 0 98.5 Centrosome-asso...
Homo sapiens
XP_001158610 0 97.7 centrosome-asso...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB006629 6.9e-05 26.6 KIAA0291
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000938 670 735 PF01302 CAP-Gly
ProfileScan IPR000938 688 730 PS50245 CAP-Gly
ScanRegExp IPR000938 688 719 PS00845 CAP-Gly
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f AGAAAAACAACCTACAGTCCC
Primer_r TGTTTGTAGGATCACGTTGTC
PCR product length 107 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp