KIAA0291

Product ID	ORK01970
Accession No	AB006629
Description	CAP-GLY domain containing linker protein 2, transcript variant 2
Clone name	fh25236
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5445 bp) Predicted protein sequence (1024 aa)
HaloTag ORF Clone	FHC01970
Flexi ORF Clone	FXC01970
Source	Human fetal brain
Rouge ID	mKIAA0291 by Kazusa Mouse cDNA Project
Note	We replaced ha06799, former representative clones for KIAA0291 with fh25236. (2001/5/29)

Length: 5445 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2082 bp
Genome contig ID	gi89161213f_73241741
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCTGTGCTCGGGACAATAAAGCTTGTGACAGGTC
Flanking genome sequence (216457 - 216506)	----+--------+--------+--------+--------+----* CAGGACCCCGGCAGTTGGCTTGTCTCCTCCTCTCCGTGGGGACCCCGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	73341741	73458196	16	99.5	Perfect prediction

Length: 1024 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69603	100.0	cytoplasmic lin...	Homo sapiens
XP_531035	99.7	cytoplasmic lin...	Pan troglodytes
EDL19427	90.9	cytoplasmic lin...	Mus musculus
AAH39162	91.5	CAP-GLY domain ...	Mus musculus
AAH53048	91.4	CAP-GLY domain ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111886	0.00029	26.1	KIAA2034
D86970	0.00047	23.5	KIAA0216
AB014539	0.00069	28.2	KIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000938	94	159	PF01302	CAP-Gly
HMMPfam	IPR000938	234	299	PF01302	CAP-Gly
ProfileScan	IPR000938	112	154	PS50245	CAP-Gly
ProfileScan	IPR000938	252	294	PS50245	CAP-Gly
ScanRegExp	IPR000938	112	143	PS00845	CAP-Gly
ScanRegExp	IPR000938	252	283	PS00845	CAP-Gly

Primer_f
Primer_r
PCR conditions	test