Gene/Protein Characteristic Table for KIAA0425
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07435
Accession No AB007885
Description zinc finger, MYM-type 4
Clone name hh01272
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6108 bp)
Predicted protein sequence (1270 aa)
Source Human adult brain
Rouge ID mKIAA0425 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6108 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1270 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX07419 0 100.0 zinc finger, MY...
Homo sapiens
AAH12093 0 100.0 ZMYM4 protein [...
Homo sapiens
Q5VZL5 0 100.0 Zinc finger MYM...
Homo sapiens
AAI27114 0 99.9 ZMYM4 protein [...
Homo sapiens
XP_513305 0 99.7 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002383 1.3e-27 40.7 KIAA0385
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010507 84 124 PF06467 Zinc finger
IPR010507 136 179 PF06467 Zinc finger
IPR010507 186 221 PF06467 Zinc finger
IPR010507 232 266 PF06467 Zinc finger
IPR010507 276 314 PF06467 Zinc finger
IPR010507 322 353 PF06467 Zinc finger
IPR010507 430 464 PF06467 Zinc finger
IPR010507 471 510 PF06467 Zinc finger
IPR010507 517 551 PF06467 Zinc finger
HMMSmart IPR011017 63 99 SM00746 TRASH
IPR011017 111 151 SM00746 TRASH
IPR011017 163 201 SM00746 TRASH
IPR011017 208 247 SM00746 TRASH
IPR011017 253 291 SM00746 TRASH
IPR011017 301 337 SM00746 TRASH
IPR011017 409 445 SM00746 TRASH
IPR011017 451 486 SM00746 TRASH
IPR011017 494 532 SM00746 TRASH
IPR011017 538 573 SM00746 TRASH
ScanRegExp IPR001545 211 217 PS00261 Gonadotropin
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTCTGTGGTTTCTGTAAGGGG
Primer_r AGTGTAGCTGTTGATGTGTGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name GeneBridge 4
Primer_f TTCTGTGGTTTCTGTAAGGGG
Primer_r AGTGTAGCTGTTGATGTGTGC
PCR product length 95 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp