KIAA1820

Gene/Protein Characteristic Table for KIAA1820

Order Kazusa clone(s) from :

Product ID	ORK01638
Accession No	AB058723
Description	retinoic acid induced 1
Clone name	hh01321
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5915 bp) Predicted protein sequence (1644 aa)
HaloTag ORF Clone	FHC01638
Flexi ORF Clone	FXC01638
Source	Human adult brain
Rouge ID	mKIAA1820 by Kazusa Mouse cDNA Project

Length: 5915 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	523 bp
Genome contig ID	gi51511734f_17425512
PolyA signal sequence (AGTAAA,-25)	+--------+--------+----*----+---- TTTCCTTAAGAGTAAAAAACAGTCATTGCATTCAG
Flanking genome sequence (229932 - 229981)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTCAATAAAGATACAACGATTGTTTTGGAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	17525512	17655442	4	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10157	100.0	retinoic acid-i...	synthetic construct
Q7Z5J4	99.9	Retinoic acid-i...	Homo sapiens
EAW55696	99.9	retinoic acid i...	Homo sapiens
AAO31738	99.8	retinoic acid i...	Homo sapiens
XP_001159372	99.3	retinoic acid i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006630	1.1e-13	25.3	KIAA0292

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CGCACCAAAACCCAGGAGATC
Primer_r	CTGGAGACCTTGAATGTGGCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CGCACCAAAACCCAGGAGATC
Primer_r	CTGGAGACCTTGAATGTGGCG
PCR product length	95 bp
PCR conditions	15 °C66 sec60 °C30 sec128 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp