KIAA1924

Product ID	ORK07360
Accession No	AB067511
Description	WD repeat domain 90
Clone name	hh01339
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5499 bp) Predicted protein sequence (613 aa)
Source	Human adult brain
Rouge ID	mKIAA1924 by Kazusa Mouse cDNA Project

Length: 5499 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3575 bp
Genome contig ID	gi51511732f_539312
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGGACACAGGCTTCTTTGCCTACACGTGCGGCCG
Flanking genome sequence (111766 - 111815)	----+--------+--------+--------+--------+----* CCTGGTGGTGGTGGAGGACCTGCACTCTGGCGCCCAGCAGCACTGGTCCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	639312	651076	26	99.7	Perfect prediction

Length: 613 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW85774	1.7e-205	100.0	hCG1985539, iso...	Homo sapiens
EAW85771	1.7e-201	98.7	hCG1985539, iso...	Homo sapiens
EAW85772	1.8e-201	98.7	hCG1985539, iso...	Homo sapiens
EAW85770	2e-200	98.5	hCG1985539, iso...	Homo sapiens
BAC03575	1.6e-163	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	502	GAAVVYPCHAVIVVLLVDTGEQR	524	PRIMARY	23

Primer_f	TACCTGTATGTGCTCTTTCGG
Primer_r	CGTGGCCGTAGACTTAAACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-