KIAA1153

Gene/Protein Characteristic Table for KIAA1153

Order Kazusa clone(s) from :

Product ID	ORK00189
Accession No	AB032979
Description	tRNA methyltransferase 6
Clone name	hh01454
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2944 bp) Predicted protein sequence (424 aa)
HaloTag ORF Clone	FHC00189
Flexi ORF Clone	FXC00189
Source	Human adult brain
Rouge ID	mKIAA1153 by Kazusa Mouse cDNA Project

Length: 2944 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1669 bp
Genome contig ID	gi51511747r_5766510
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TGTTCTAAATAAAGTGACTAGAATTTTTGTGTACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCAATTAAAGGAAACAAATGTCTTTTCCCCCTCTATGGTCTTATGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	5866510	5879123	9	99.7	Perfect prediction

Features of the protein sequence

Description

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX10407	1.1e-152	100.0	CGI-09 protein,...	Homo sapiens
Q9UJA5	2e-139	98.2	tRNA (adenine-N...	Homo sapiens
XP_001166710	9.5e-139	97.6	CGI-09 protein ...	Pan troglodytes
XP_001115807	1.5e-137	96.9	similar to CGI-...	Macaca mulatta
XP_542900	1.7e-132	87.4	similar to CGI-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007316	41	342	PF04189	Eukaryotic initiation factor 3

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CAATATGGATGTGTGAGTGTG
Primer_r	CCCTACTAAACCTTTCTATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 20

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAATATGGATGTGTGAGTGTG
Primer_r	CCCTACTAAACCTTTCTATGC
PCR product length	176 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp