KIAA0558

Product ID	ORK00563
Accession No	AB011130
Description	calcium channel, voltage-dependent, alpha 2/delta subunit 2, transcript variant 1
Clone name	hh01485
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5303 bp) Predicted protein sequence (1145 aa)
HaloTag ORF Clone	FHC00563
Flexi ORF Clone	FXC00563
Source	Human adult brain
Rouge ID	mKIAA0558 by Kazusa Mouse cDNA Project

Length: 5303 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1864 bp
Genome contig ID	gi89161205r_50275237
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GATCAGTTATTAAATAATGTTCATATTTTCACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGGTTCCCATCCACTGTATCAGCTTGGGGGTGAGGACTGGGTAGCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	50375237	50515859	38	100.0	Perfect prediction

Length: 1145 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65119	99.9	calcium channel...	Homo sapiens
CAB86192	99.7	calcium channel...	Homo sapiens
Q9NY47	99.0	Voltage-depende...	Homo sapiens
XP_001090735	98.1	similar to calc...	Macaca mulatta
AAI58059	96.5	Cacna2d2 protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013608	141	265	PF08399	VWA N-terminal
	IPR002035	291	469	PF00092	von Willebrand factor
	IPR004010	485	574	PF02743	Cache
	IPR013680	580	666	PF08473	Voltage-dependent calcium channel
HMMSmart	IPR002035	289	464	SM00327	von Willebrand factor
ProfileScan	IPR002035	291	469	PS50234	von Willebrand factor

Primer_f	TTACAAGGAATCACACACACG
Primer_r	GCCATTTCCTTTTCTCTGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTACAAGGAATCACACACACG
Primer_r	GCCATTTCCTTTTCTCTGCCC
PCR product length	120 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles