Gene/Protein Characteristic Table for KIAA1178
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04495
Accession No AB033004
Description CD2 (cytoplasmic tail) binding protein 2
Clone name hh01688a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (2592 bp)
Predicted protein sequence (124 aa)
Source Human adult brain
Rouge ID mKIAA1178 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 2592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 124 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAQ13502 2.1e-53 100.0 FWP010 [Homo sa...
Homo sapiens
O95400 3.4e-53 100.0 CD2 antigen cyt...
Homo sapiens
XP_001110388 1.6e-51 96.8 CD2 antigen (cy...
Macaca mulatta
CAH91235 3.1e-51 97.6 hypothetical pr...
Pongo abelii
CAH91742 3.1e-51 97.6 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003169 64 121 PF02213 GYF
HMMSmart IPR003169 64 121 SM00444 GYF
ProfileScan IPR003169 63 121 PS50829 GYF
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCATCGAGAAGACATTGGGAC
Primer_r AGATTAGGGAAGACACTGGCT
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f GCATCGAGAAGACATTGGGAC
Primer_r AGATTAGGGAAGACACTGGCT
PCR product length 156 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp