KIAA0632

Product ID	ORK00581
Accession No	AB014532
Description	pentatricopeptide repeat domain 1
Clone name	hh01900
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5413 bp) Predicted protein sequence (727 aa)
HaloTag ORF Clone	FHC00581
Flexi ORF Clone	FXC00581
Source	Human adult brain
Rouge ID	mKIAA0632 by Kazusa Mouse cDNA Project

Length: 5413 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3228 bp
Genome contig ID	gi89161213r_98752584
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGTGGAACAGAGCAAGACCCTGTTTC
Flanking genome sequence (99714 - 99665)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGCCAAGAGCGGTGGACCACGCCTATAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	98852298	98874306	8	100.0	Perfect prediction

Length: 727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG58700	98.6	unnamed protein...	Homo sapiens
O75127	100.0	Pentatricopepti...	Homo sapiens
AAH80580	99.9	Pentatricopepti...	Homo sapiens
AAI03496	99.9	Pentatricopepti...	Homo sapiens
XP_519233	98.6	pentatricopepti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002885	201	235	PF01535	Pentatricopeptide repeat
	IPR002885	275	309	PF01535	Pentatricopeptide repeat
	IPR002885	548	582	PF01535	Pentatricopeptide repeat
	IPR002885	615	649	PF01535	Pentatricopeptide repeat
HMMTigr	IPR002885	201	235	TIGR00756	Pentatricopeptide repeat
	IPR002885	275	309	TIGR00756	Pentatricopeptide repeat
	IPR002885	310	346	TIGR00756	Pentatricopeptide repeat
	IPR002885	548	582	TIGR00756	Pentatricopeptide repeat
	IPR002885	615	649	TIGR00756	Pentatricopeptide repeat

Primer_f	GAGATTGACCCCAGACCTAAC
Primer_r	TTTGGTTGGGCTGGAATGTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGGACTTCGTGAGACTCGC
Primer_r	CAGGGGTCCAGGTGTTGCAGG
PCR product length	81 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles