KIAA1671

Product ID	ORK00884
Accession No	AB051458
Description	KIAA1671
Clone name	hh02164
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6123 bp) Predicted protein sequence (364 aa)
Source	Human adult brain
Rouge ID	mKIAA1671 by Kazusa Mouse cDNA Project

Length: 6123 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5028 bp
Genome contig ID	gi89161203f_23696180
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TATGAAAATAGCAAATAAAGCTTTGGTGCAAGTTG
Flanking genome sequence (227227 - 227276)	----+--------+--------+--------+--------+----* CATTGGAGAAGTCGGTGCGTCCATGTGTGAATGAATAGAGTCTCCCATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	23796180	23923405	8	99.1	Perfect prediction

Length: 364 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001103310	3.5e-120	97.0	hypothetical pr...	Macaca mulatta
AAI71801	9.6e-100	100.0	Unknown (protei...	Homo sapiens
XP_854551	1.1e-82	86.2	similar to tank...	Canis lupus fam...
XP_222271	2.5e-77	76.4	similar to tank...	Rattus norvegicus
XP_001080521	1.2e-70	75.4	similar to tank...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051528	7.8e-06	28.2	KIAA1741

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-