KIAA0434

Product ID	ORK04290
Accession No	AB007894
Description	bassoon presynaptic cytomatrix protein
Clone name	hh02165
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5650 bp) Predicted protein sequence (1571 aa)
Source	Human adult brain
Rouge ID	mKIAA0434 by Kazusa Mouse cDNA Project

Length: 5650 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	933 bp
Genome contig ID	gi89161205f_49569058
PolyA signal sequence (CATAAA,-27)	+--------+--------+----*----+---- GTATACCTCATAAACATTTTTCTTTTGTTTCTCTC
Flanking genome sequence (111799 - 111848)	----+--------+--------+--------+--------+----* TCCCCCTTTCTCTCTTCTCTTGGCTCACTCCCTTGCCTCTCCCCCTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	49669058	49680855	8	100.0	Perfect prediction

Length: 1571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA77176	100.0	Bassoon protein...	Homo sapiens
Q9UPA5	100.0	Protein bassoon...	Homo sapiens
NP_003449	99.9	bassoon protein...	Homo sapiens
AAC83555	99.9	neuronal double...	Homo sapiens
XP_516463	99.2	bassoon protein...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011131	1.7e-10	32.9	KIAA0559

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008165	1454	1495	PD003992	Protein of unknown function GLTT

Primer_f	CATCACAGGAGGAGAGGCAGC
Primer_r	TTCCCGCTCTAGCTCCTCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACGCTGCTTTTCGGTGCTATG
Primer_r	CCGTTTCCTTCACATTCCAGC
PCR product length	187 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles