Gene/Protein Characteristic Table for KIAA0571
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00100
Accession No AB011143
Description GRB2-associated binding protein 2, transcript variant 2
Clone name hh02388
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6052 bp)
Predicted protein sequence (683 aa)
Flexi ORF Clone FXC00100
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 6052 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 683 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UQC2 0 100.0 GRB2-associated...
Homo sapiens
XP_001093917 0 98.9 similar to GRB2...
Macaca mulatta
EAW75057 0 100.0 GRB2-associated...
Homo sapiens
XP_542285 9.6e-213 94.3 similar to GRB2...
Canis lupus fam...
AAI03527 7.5e-203 91.6 Growth factor r...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 32 124 PF00169 Pleckstrin-like
HMMSmart IPR001849 15 126 SM00233 Pleckstrin-like
ProfileScan IPR001849 19 124 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCCCAGTCTTGAGTTCTTGTC
Primer_r AGTAGAAAGGGACCTGCAAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f GCCCAGTCTTGAGTTCTTGTC
Primer_r AGTAGAAAGGGACCTGCAAGC
PCR product length 225 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp