Gene/Protein Characteristic Table for KIAA0572
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05948
Accession No AB011144
Description minichromosome maintenance complex component 3 associated protein
Clone name hh02391
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5755 bp)
Predicted protein sequence (1872 aa)
Source Human adult brain
Rouge ID mKIAA0572 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1872 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60318 0 100.0 80 kDa MCM3-ass...
Homo sapiens
AAI04959 0 100.0 Minichromosome ...
Homo sapiens
XP_525497 0 99.3 minichromosome ...
Pan troglodytes
XP_001488118 0 86.2 minichromosome ...
Equus caballus
BAH14134 0 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005062 576 802 PF03399 SAC3/GANP/Nin1/mts3/eIF-3 p25
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ACATGATGAGGGAGCAACTGC
Primer_r ATTTCCAACAGTGCATCAAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 21
Experimental conditions
Panel name GeneBridge 4
Primer_f ACATGATGAGGGAGCAACTGC
Primer_r ATTTCCAACAGTGCATCAAGC
PCR product length 250 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp