KIAA0825

Product ID	ORK05624
Accession No	AB020632
Description	KIAA0825
Clone name	hh03427
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5751 bp) Predicted protein sequence (553 aa)
Source	Human adult brain

Length: 5751 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4087 bp
Genome contig ID	gi51511721r_93674711
PolyA signal sequence (None)	+--------+--------+----*----+---- CACCCCAGCCTGGGCAATGAGTGGGGCTTCGTCTC
Flanking genome sequence (99724 - 99675)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATCCATGTACTCAACATATACTCAAGTCCTGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	93774435	93838645	9	99.2	Perfect prediction

Length: 553 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW96022	0	99.8	hCG2016227, iso...	Homo sapiens
EAW96021	0	99.8	hCG2016227, iso...	Homo sapiens
XP_517655	0	97.8	hypothetical pr...	Pan troglodytes
XP_001091049	4e-216	94.7	similar to CG14...	Macaca mulatta
XP_536295	5.1e-192	85.4	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CCTGCTAAATCACTGTCTATG
Primer_r	AATTGGTGGACAGTCTTAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 5

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCTGCTAAATCACTGTCTATG
Primer_r	AATTGGTGGACAGTCTTAGGC
PCR product length	164 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles