KIAA0930

Product ID	ORK04385
Accession No	AB023147
Description	KIAA0930
Clone name	hh03471
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4134 bp) Predicted protein sequence (348 aa)
Source	Human adult brain
Rouge ID	mKIAA0930 by Kazusa Mouse cDNA Project

Length: 4134 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3085 bp
Genome contig ID	gi89161203r_43868920
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTAGCCTGGGCAACGAGAGCGAAACTCTGTCTC
Flanking genome sequence (99717 - 99668)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATACATTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	43968637	43986550	9	99.2	Perfect prediction

Length: 348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH53595	2e-143	100.0	C22orf9 protein...	Homo sapiens
BAF98774	2.1e-143	100.0	unnamed protein...	Homo sapiens
Q6ICG6	2.1e-143	100.0	Uncharacterized...	Homo sapiens
BAC85917	2.2e-143	100.0	unnamed protein...	Homo sapiens
EAW73374	2.2e-143	100.0	chromosome 22 o...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTTTAGGGATCTTCTCTGTGG
Primer_r	AGAAAGCCCCAAAGTAGTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 22

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTTTAGGGATCTTCTCTGTGG
Primer_r	AGAAAGCCCCAAAGTAGTCCC
PCR product length	103 bp
PCR conditions	95 °C15 sec64 °C60 sec35 cycles