KIAA1109

Product ID	ORK01148
Accession No	AB029032
Description	KIAA1109
Clone name	hh03530s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9765 bp) Predicted protein sequence (3086 aa)
Flexi ORF Clone	FXC01148
Source	Human adult brain
Rouge ID	mKIAA1109 by Kazusa Mouse cDNA Project
Note	We replaced hh03530, former representative clones for KIAA1109 with hh03530s1. (2002/5/10)

Length: 9765 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	503 bp
Genome contig ID	gi89161207f_123291013
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGTTAACTATTATAATAAAGTCACAGTAATGGTTT
Flanking genome sequence (212344 - 212393)	----+--------+--------+--------+--------+----* AAGTCTGTAGTAGTTTTTCAATCTTTTTCTCCTTTTTATAATTAATAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	123391013	123503355	50	100.0	Perfect prediction

Length: 3086 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056127	100.0	hypothetical pr...	Homo sapiens
XP_517422	99.8	similar to frag...	Pan troglodytes
XP_001102884	99.3	similar to CG15...	Macaca mulatta
XP_540963	98.4	similar to CG15...	Canis lupus fam...
CAM24476	97.4	novel protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001969	1437	1448	PS00141	Peptidase aspartic

Primer_f	GACTGGAGAGATTTTATGTGC
Primer_r	GTCCTAGCATGATGAAAGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GACTGGAGAGATTTTATGTGC
Primer_r	GTCCTAGCATGATGAAAGCCC
PCR product length	134 (2.0k) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles