Gene/Protein Characteristic Table for KIAA1109
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01148
Accession No AB029032
Description KIAA1109
Clone name hh03530s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (9765 bp)
Predicted protein sequence (3086 aa)
Source Human adult brain
Rouge ID mKIAA1109 by Kazusa Mouse cDNA Project
Note We replaced hh03530, former representative clones for KIAA1109 with hh03530s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 9765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 503 bp
Genome contig ID gi89161207f_123291013
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGTTAACTATTATAATAAAGTCACAGTAATGGTTT
Flanking genome sequence
(212344 - 212393)
----+----*----+----*----+----*----+----*----+----*
AAGTCTGTAGTAGTTTTTCAATCTTTTTCTCCTTTTTATAATTAATAGAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 f 123391013 123503355 50 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 3086 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_056127 0 100.0 hypothetical pr...
Homo sapiens
XP_517422 0 99.8 similar to frag...
Pan troglodytes
XP_001102884 0 99.3 similar to CG15...
Macaca mulatta
XP_540963 0 98.4 similar to CG15...
Canis lupus fam...
CAM24476 0 97.4 novel protein [...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR001969 1437 1448 PS00141 Peptidase aspartic
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GACTGGAGAGATTTTATGTGC
Primer_r GTCCTAGCATGATGAAAGCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f GACTGGAGAGATTTTATGTGC
Primer_r GTCCTAGCATGATGAAAGCCC
PCR product length 134 (2.0k) bp
PCR conditions 95 °C15 sec62 °C120 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp