KIAA0826

Gene/Protein Characteristic Table for KIAA0826

Order Kazusa clone(s) from :

Product ID	ORK05235
Accession No	AB020633
Description	FRY-like
Clone name	hh03638
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5770 bp) Predicted protein sequence (1236 aa)
Source	Human adult brain
Rouge ID	mKIAA0826 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5770 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2059 bp
Genome contig ID	gi89161207r_48094137
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCTATTAATATAATAAAAATGAATATACCTGCAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCAAGATGCAAACAAATTCATTAGGATGGCCTTCTGCAACAGCATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	48194137	48241626	21	99.8	Perfect prediction

Features of the protein sequence

Description

Length: 1236 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG54477	100.0	unnamed protein...	Homo sapiens
EAW93066	100.0	hCG1755809, iso...	Homo sapiens
O94915	100.0	Protein furry h...	Homo sapiens
XP_001917163	96.8	FRY-like [Equus...	Equus caballus
XP_588315	95.5	similar to furr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAACTTTTGGGTGTGGGGCAG
Primer_r	ACAACACAAACCAACAGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 4

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp