KIAA1670

Product ID	ORK04620
Accession No	AB051457
Description	carnitine palmitoyltransferase 1B (muscle)
Clone name	hh04251
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4906 bp) Predicted protein sequence (598 aa)
Source	Human adult brain

Length: 4906 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	952 bp
Genome contig ID	gi89161203r_49254164
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCCACGTGTTTGCTTGGAATAAATACTTGCCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTTCACCTGTTCCCTGGGGCCATTTCTGTTTGTCTGTCTGCTGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	49354164	49368260	27	99.7	Perfect prediction

Length: 598 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525636	99.3	carnitine palmi...	Pan troglodytes
NP_689453	99.8	carnitine palmi...	Homo sapiens
AAC51122	100.0	carnitine palmi...	Homo sapiens
Q92523	99.8	Carnitine O-pal...	Homo sapiens
BAD96894	99.8	carnitine palmi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000542	189	598	PF00755	Acyltransferase ChoActase/COT/CPT
ScanRegExp	IPR000542	190	205	PS00439	Acyltransferase ChoActase/COT/CPT
ScanRegExp	IPR000542	468	495	PS00440	Acyltransferase ChoActase/COT/CPT

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-