KIAA1051

Product ID	ORK00723
Accession No	AB028974
Description	paternally expressed 10
Clone name	hh04271
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6188 bp) Predicted protein sequence (402 aa)
HaloTag ORF Clone	FHC00723
Flexi ORF Clone	FXC00723
Source	Human adult brain
Rouge ID	mKIAA1051 by Kazusa Mouse cDNA Project

Length: 6188 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4010 bp
Genome contig ID	gi89161213f_94030753
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AATAAAAATTCAATAAAGATTTAGTGGTTAAGTGC
Flanking genome sequence (106189 - 106238)	----+--------+--------+--------+--------+----* AAACTGTGTCCTGATCATTTCAGCATCTACCAGCATCAAGGGAATGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	94130753	94136940	1	99.0	Perfect prediction

Length: 402 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86TG7	7.5e-133	100.0	Retrotransposon...	Homo sapiens
XP_001915670	8.4e-127	95.6	paternally expr...	Equus caballus
NP_001120682	1.8e-123	92.7	paternally expr...	Bos taurus
NP_001120696	2.1e-114	93.8	paternally expr...	Sus scrofa
Q7TN75	2.3e-42	50.3	Retrotransposon...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ATGTGAAGCTGCCAATGGATG
Primer_r	CAGTTCAAGGTAGTAGCAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAACTTGTCAATGATGGATGG
Primer_r	GGCAATGGGGTTCAGTGGTAG
PCR product length	113 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles