Order Kazusa clone(s) from : ![]() |
Product ID | ORK00755 |
---|---|
Accession No | AB032997 |
Description | TBC1 domain family, member 24, transcript variant 1 |
Clone name | hh05501s1 |
Vector information | |
cDNA sequence | DNA sequence (4340 bp) Predicted protein sequence (595 aa) |
HaloTag ORF Clone |
FHC00755
![]() |
Flexi ORF Clone | FXC00755 |
Source | Human adult brain |
Rouge ID |
mKIAA1171
by Kazusa Mouse cDNA Project
|
Note | We replaced hh05501, former representative clones for KIAA1171 with hh05501s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2527 bp |
---|---|
Genome contig ID | gi51511732f_2386034 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107455 - 107504) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 2465155 | 2493487 | 8 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000195 | 83 | 298 | PF00566 | RabGAP/TBC |
IPR006571 | 404 | 590 | PF07534 | TLDc | |
HMMSmart | IPR000195 | 78 | 295 | SM00164 | RabGAP/TBC |
IPR006571 | 378 | 590 | SM00584 | TLDc |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 164 | ISFCPALPAVVALLLHYSIDEAE | 186 | PRIMARY | 23 | 2 | 260 | YFARVFDVFLVEGYKVLYRVALA | 282 | SECONDARY | 23 |
---|
![]() |
Primer_f | CTATGACTGGAATGCTGCAAG |
---|---|
Primer_r | AACCTGCTGGACTTAACTCGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |