Order Kazusa clone(s) from : ![]() |
Product ID | ORK05843 |
---|---|
Accession No | AB033000 |
Description | limb development membrane protein 1-like |
Clone name | hh05825a |
Vector information | |
cDNA sequence | DNA sequence (2800 bp) Predicted protein sequence (430 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1174
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1506 bp |
---|---|
Genome contig ID | gi89161190r_47677208 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 47777208 | 47790717 | 15 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR008075 | 107 | 129 | PR01692 | Lipocalin-1 receptor |
IPR008075 | 149 | 171 | PR01692 | Lipocalin-1 receptor | |
IPR008075 | 229 | 250 | PR01692 | Lipocalin-1 receptor | |
IPR008075 | 336 | 357 | PR01692 | Lipocalin-1 receptor | |
IPR008075 | 394 | 414 | PR01692 | Lipocalin-1 receptor | |
HMMPfam | IPR006876 | 62 | 430 | PF04791 | LMBR1-like conserved region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | CEERPLGWVWVLGGGGFLPARP | 22 | SECONDARY | 22 | 2 | 58 | RECIISTLLFATLYILCHIFLTR | 80 | PRIMARY | 23 | 3 | 104 | LCTFTLAIALGAVLLLPFSIISN | 126 | PRIMARY | 23 | 4 | 148 | GLWNLVFLFSNLSLIFLMPFAYF | 170 | PRIMARY | 23 | 5 | 191 | TVVMLMLLTLLVLGMVWVASAIV | 213 | PRIMARY | 23 | 6 | 237 | CISFLGVLLLLVCTPLGLARMFS | 259 | PRIMARY | 23 | 7 | 340 | MLCLLVLTGLSVLIVAIHILELL | 362 | PRIMARY | 23 | 8 | 383 | SKLGSFGAVIQVVLILYPSGNPS | 405 | PRIMARY | 23 |
---|
![]() |
Primer_f | CTGAGCAGAGTATGGAAGCAC |
---|---|
Primer_r | AAGATGTGGCAGAGGATGTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGGCTCGGGAGATAGATTGTC |
Primer_r | CCTATCCCCTTGGTCTTTCAG |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |