Order Kazusa clone(s) from : ![]() |
Product ID | ORK05394 |
---|---|
Accession No | AB067513 |
Description | hyaluronan and proteoglycan link protein 4 |
Clone name | hh10052 |
Vector information | |
cDNA sequence | DNA sequence (5409 bp) Predicted protein sequence (412 aa) |
Flexi ORF Clone | FXC05394 |
Source | Human adult brain |
Rouge ID |
mKIAA1926
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3069 bp |
---|---|
Genome contig ID | gi42406306r_19126734 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99823 - 99774) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 19226557 | 19245178 | 12 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000538 | 174 | 221 | PD000918 | Link |
FPrintScan | IPR000538 | 183 | 195 | PR01265 | Link |
IPR000538 | 211 | 224 | PR01265 | Link | |
IPR000538 | 229 | 240 | PR01265 | Link | |
HMMPfam | IPR013106 | 56 | 157 | PF07686 | Immunoglobulin V-set |
IPR000538 | 172 | 277 | PF00193 | Link | |
IPR000538 | 283 | 374 | PF00193 | Link | |
HMMSmart | IPR003599 | 63 | 171 | SM00409 | Immunoglobulin subtype |
IPR003598 | 69 | 160 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 73 | 155 | SM00406 | Immunoglobulin V-set | |
IPR000538 | 171 | 278 | SM00445 | Link | |
IPR000538 | 282 | 375 | SM00445 | Link | |
ProfileScan | IPR007110 | 56 | 171 | PS50835 | Immunoglobulin-like |
IPR000538 | 173 | 278 | PS50963 | Link | |
IPR000538 | 283 | 375 | PS50963 | Link | |
ScanRegExp | IPR000538 | 195 | 240 | PS01241 | Link |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 16 | AALGPGALWAAAWGVLLLTAP | 36 | PRIMARY | 21 |
![]() |
Primer_f | ATGTCACTAGTTATGCAGAGC |
---|---|
Primer_r | GCCAATGAGATGAGAAATGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |