KIAA1926

Product ID	ORK05394
Accession No	AB067513
Description	hyaluronan and proteoglycan link protein 4
Clone name	hh10052
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5409 bp) Predicted protein sequence (412 aa)
HaloTag ORF Clone	FHC05394
Flexi ORF Clone	FXC05394
Source	Human adult brain
Rouge ID	mKIAA1926 by Kazusa Mouse cDNA Project

Length: 5409 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3069 bp
Genome contig ID	gi42406306r_19126734
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TCAAAAAATAAAAATAAGTAAATCTCCTCTTCCTC
Flanking genome sequence (99823 - 99774)	----+--------+--------+--------+--------+----* ATTCTTCTGACAGTCTGAAGAGGATCAATGGTTTGGATTGAATGCATCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	19226557	19245178	12	100.0	Perfect prediction

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86UW8	9.6e-164	100.0	Hyaluronan and ...	Homo sapiens
XP_001115151	1e-161	98.8	similar to brai...	Macaca mulatta
XP_001115139	2.9e-161	98.8	similar to brai...	Macaca mulatta
EDL28779	1.9e-147	90.4	hyaluronan and ...	Mus musculus
Q80WM4	2.9e-147	90.6	Hyaluronan and ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87433	6.2e-05	39.4	KIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000538	174	221	PD000918	Link
FPrintScan	IPR000538	183	195	PR01265	Link
	IPR000538	211	224	PR01265	Link
	IPR000538	229	240	PR01265	Link
HMMPfam	IPR013106	56	157	PF07686	Immunoglobulin V-set
	IPR000538	172	277	PF00193	Link
	IPR000538	283	374	PF00193	Link
HMMSmart	IPR003599	63	171	SM00409	Immunoglobulin subtype
	IPR003598	69	160	SM00408	Immunoglobulin subtype 2
	IPR003596	73	155	SM00406	Immunoglobulin V-set
	IPR000538	171	278	SM00445	Link
	IPR000538	282	375	SM00445	Link
ProfileScan	IPR007110	56	171	PS50835	Immunoglobulin-like
	IPR000538	173	278	PS50963	Link
	IPR000538	283	375	PS50963	Link
ScanRegExp	IPR000538	195	240	PS01241	Link

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	AALGPGALWAAAWGVLLLTAP	36	PRIMARY	21

Primer_f	ATGTCACTAGTTATGCAGAGC
Primer_r	GCCAATGAGATGAGAAATGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-