KIAA1500

Product ID	ORK05229
Accession No	AB040933
Description	Fraser extracellular matrix complex subunit 1
Clone name	hh12031s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9853 bp) Predicted protein sequence (2240 aa)
Source	Human adult brain
Rouge ID	mKIAA1500 by Kazusa Mouse cDNA Project
Note	We replaced hh12031, former representative clones for KIAA1500 with hh12031s1. (2003/4/2)

Length: 9853 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3129 bp
Genome contig ID	gi89161207f_79478846
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GTATATGCCACTATATAAATTTGTATTAATAAATG
Flanking genome sequence (205587 - 205636)	----+--------+--------+--------+--------+----* ACAGTCTTGTTGGTTTTTTGTTTGTTTTCCTATGTTCTTTTTAGATTATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	79578846	79684431	36	99.5	Perfect prediction

Length: 2240 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX05821	99.9	Fraser syndrome...	Homo sapiens
NP_079350	99.8	Fraser syndrome...	Homo sapiens
Q86XX4	99.5	Extracellular m...	Homo sapiens
XP_517202	99.3	Fraser syndrome...	Pan troglodytes
XP_001492196	93.3	similar to Fras...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075823	9.5e-06	22.0	KIAA1943
AB029010	0.00011	27.3	KIAA1087

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003644	783	878	PF03160	Na-Ca exchanger/integrin-beta4
	IPR003644	891	1002	PF03160	Na-Ca exchanger/integrin-beta4
	IPR003644	1016	1108	PF03160	Na-Ca exchanger/integrin-beta4
	IPR003644	1137	1239	PF03160	Na-Ca exchanger/integrin-beta4
	IPR003644	1257	1361	PF03160	Na-Ca exchanger/integrin-beta4
HMMSmart	IPR003644	770	878	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	891	1002	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	1017	1122	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	1137	1239	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	1257	1361	SM00237	Na-Ca exchanger/integrin-beta4

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2134	IGSALAAIMLLLLVFLVACFIN	2155	PRIMARY	22

Primer_f	TTGTAACTGTGTAACTGCTCC
Primer_r	ACTCTAGCTTCATTCTGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-