Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00727 |
---|---|
Accession No | AB028982 |
Description | sortilin-related VPS10 domain containing receptor 3 |
Clone name | hh12158 |
Vector information | |
cDNA sequence | DNA sequence (5757 bp) Predicted protein sequence (1297 aa) |
HaloTag ORF Clone |
FHC00727
|
Flexi ORF Clone | FXC00727 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1861 bp |
---|---|
Genome contig ID | gi89161187f_106290849 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (724136 - 724185) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 106390849 | 107014983 | 26 | 100.0 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002860 | 306 | 317 | PF02012 | Glycoside hydrolase |
IPR002860 | 354 | 365 | PF02012 | Glycoside hydrolase | |
IPR002860 | 395 | 406 | PF02012 | Glycoside hydrolase | |
IPR002860 | 590 | 601 | PF02012 | Glycoside hydrolase | |
IPR002860 | 667 | 678 | PF02012 | Glycoside hydrolase | |
IPR002860 | 709 | 720 | PF02012 | Glycoside hydrolase | |
IPR000601 | 901 | 985 | PF00801 | PKD | |
HMMSmart | IPR006581 | 294 | 896 | SM00602 | VPS10 |
ProfileScan | IPR000601 | 935 | 979 | PS50093 | PKD |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1172 | LKPGVQVIVYVTQLTLAPLVDSS | 1194 | SECONDARY | 23 | 2 | 1200 | SAMLMLLSVVFVGLAVFLIYK | 1220 | PRIMARY | 21 |
---|
RT-PCR-ELISA |
Primer_f | GTTCCCATTCTTCTTTGTGAG |
---|---|
Primer_r | ATTGTCTGCCCCATTTAACCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTCCCATTCTTCTTTGTGAG |
Primer_r | ATTGTCTGCCCCATTTAACCC |
PCR product length | 132 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |