Order Kazusa clone(s) from : ![]() |
Product ID | ORK02024 |
---|---|
Accession No | AB033087 |
Description | transducin-like enhancer of split 4, transcript variant 3 |
Clone name | hh15855b |
Vector information | |
cDNA sequence | DNA sequence (2754 bp) Predicted protein sequence (787 aa) |
HaloTag ORF Clone |
FHC02024
![]() |
Flexi ORF Clone | FXC02024 |
Source | Human adult brain |
Rouge ID |
mKIAA1261
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 353 bp |
---|---|
Genome contig ID | gi89161216f_81277447 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (252787 - 252836) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 81377447 | 81530232 | 19 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 629 | 662 | PD000018 | WD40 repeat |
FPrintScan | IPR001680 | 606 | 620 | PR00320 | WD40 repeat |
IPR001680 | 648 | 662 | PR00320 | WD40 repeat | |
IPR009146 | 686 | 708 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 709 | 727 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 728 | 747 | PR01850 | Groucho/transducin-like enhancer | |
IPR001680 | 730 | 744 | PR00320 | WD40 repeat | |
IPR009146 | 748 | 767 | PR01850 | Groucho/transducin-like enhancer | |
IPR009146 | 768 | 787 | PR01850 | Groucho/transducin-like enhancer | |
HMMPfam | IPR005617 | 22 | 155 | PF03920 | Groucho/TLE |
IPR001680 | 492 | 528 | PF00400 | WD40 repeat | |
IPR001680 | 548 | 575 | PF00400 | WD40 repeat | |
IPR001680 | 581 | 619 | PF00400 | WD40 repeat | |
IPR001680 | 623 | 661 | PF00400 | WD40 repeat | |
IPR001680 | 705 | 743 | PF00400 | WD40 repeat | |
IPR001680 | 756 | 784 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 491 | 528 | SM00320 | WD40 repeat |
IPR001680 | 534 | 575 | SM00320 | WD40 repeat | |
IPR001680 | 580 | 619 | SM00320 | WD40 repeat | |
IPR001680 | 622 | 661 | SM00320 | WD40 repeat | |
IPR001680 | 664 | 702 | SM00320 | WD40 repeat | |
IPR001680 | 704 | 743 | SM00320 | WD40 repeat | |
IPR001680 | 744 | 784 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 497 | 670 | PS50294 | WD40 repeat |
IPR001680 | 587 | 628 | PS50082 | WD40 repeat | |
IPR001680 | 629 | 670 | PS50082 | WD40 repeat | |
IPR001680 | 711 | 742 | PS50082 | WD40 repeat | |
IPR001680 | 711 | 787 | PS50294 | WD40 repeat | |
ScanRegExp | IPR001680 | 606 | 620 | PS00678 | WD40 repeat |
IPR001680 | 648 | 662 | PS00678 | WD40 repeat |
![]() |
Primer_f | ATCCCCGCATCTAAAACCAAG |
---|---|
Primer_r | AGTAGACAGCTGAAGATTTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCCCCGCATCTAAAACCAAG |
Primer_r | AGTAGACAGCTGAAGATTTGG |
PCR product length | 142 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |