KIAA1158

Product ID	ORK00752
Accession No	AB032984
Description	sodium channel, voltage gated, type III beta subunit, transcript variant 1
Clone name	hj00081
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5306 bp) Predicted protein sequence (230 aa)
HaloTag ORF Clone	FHC00752
Flexi ORF Clone	FXC00752
Source	Human adult brain
Rouge ID	mKIAA1158 by Kazusa Mouse cDNA Project

Length: 5306 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4611 bp
Genome contig ID	gi51511727r_122905107
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCCTTGTTCATGTCAATAAAGTATCCCTGAAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGTCTCTGGTTTTGCTCTACTTACTAAGTGTGTCTGCACCATAGACTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	123005107	123030165	7	99.1	Perfect prediction

Length: 230 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104555	3.9e-101	99.1	similar to Sodi...	Macaca mulatta
Q9NY72	4e-94	100.0	Sodium channel ...	Homo sapiens
Q8HXJ7	2.1e-93	99.1	Sodium channel ...	Macaca fascicularis
XP_001503479	4.7e-93	98.6	similar to Sodi...	Equus caballus
Q2KI11	7.8e-93	98.6	Sodium channel ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	37	158	PF07686	Immunoglobulin V-set
HMMSmart	IPR003599	45	155	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	39	138	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	21	RLFPLASLVLIYWVSVCFPVCVE	43	PRIMARY	23
SOSUI2	2	171	VVSEIMMYILLVFLTLWLLIEMI	193	PRIMARY	23

Primer_f	TAGACCTTTAGTGTGCCATGC
Primer_r	AAGTGCTTATCTCCTGCGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-