KIAA0575

Product ID	ORK01094
Accession No	AB011147
Description	growth regulation by estrogen in breast cancer 1
Clone name	hj00216
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5285 bp) Predicted protein sequence (952 aa)
HaloTag ORF Clone	FHC01094
Flexi ORF Clone	FXC01094
Source	Human adult brain
Rouge ID	mKIAA0575 by Kazusa Mouse cDNA Project

Length: 5285 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2332 bp
Genome contig ID	gi89161199f_11569845
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGTTCCAGTCTTATAAATAAAACTTATAATGCATG
Flanking genome sequence (130520 - 130569)	----+--------+--------+--------+--------+----* TATTGTTTTGTTGGTGAGTATTCATAGCACTGTTTCGAGATAAGGTAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	11669845	11700363	16	99.5	Perfect prediction

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11207	100.0	GREB1 protein [...	synthetic construct
Q4ZG55	99.9	Protein GREB1; ...	Homo sapiens
AAH54502	99.9	GREB1 protein [...	Homo sapiens
EAX00925	99.8	GREB1 protein, ...	Homo sapiens
XP_001159582	99.3	GREB1 protein i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCCTGGGTTCAAGTGATTCTC
Primer_r	TTTGGAGGATGAGGTGGGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TACTTCCTGTCCTGCCATTCG
Primer_r	GAACCTACTTGGCTGAAATCC
PCR product length	130 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles