KIAA1134

Gene/Protein Characteristic Table for KIAA1134

Order Kazusa clone(s) from :

Product ID	ORK04600
Accession No	AB032960
Description	component of oligomeric golgi complex 6
Clone name	hj00883
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5148 bp) Predicted protein sequence (611 aa)
Source	Human adult brain
Rouge ID	mKIAA1134 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5148 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3310 bp
Genome contig ID	gi51511729f_39027874
PolyA signal sequence (AATATA,-22)	+--------+--------+----*----+---- AACCAACATTTTAAATATATGGTTAATAAGGTTTT
Flanking genome sequence (235930 - 235979)	----+--------+--------+--------+--------+----* ATATCTGTTGTGGTGTCATTTTTTGGAAATTTTCTATTGTCATAAACAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	39127874	39263802	19	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 611 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX08618	100.0	component of ol...	Homo sapiens
CAH72240	100.0	component of ol...	Homo sapiens
Q9Y2V7	100.0	Conserved oligo...	Homo sapiens
BAG57684	100.0	unnamed protein...	Homo sapiens
XP_509639	99.8	component of ol...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010490	51	609	PF06419	Conserved oligomeric complex COG6

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTGGCAGAGATAGCATTACGC
Primer_r	GCTAAGGTCCAGGGTAAGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 13

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGGCAGAGATAGCATTACGC
Primer_r	GCTAAGGTCCAGGGTAAGAGG
PCR product length	169 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp