KIAA1136

Gene/Protein Characteristic Table for KIAA1136

Order Kazusa clone(s) from :

Product ID	ORK05344
Accession No	AB032962
Description	G protein-coupled receptor 158
Clone name	hj01467
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4789 bp) Predicted protein sequence (596 aa)
Source	Human adult brain
Rouge ID	mKIAA1136 by Kazusa Mouse cDNA Project
Note	We replaced hj02663, former representative clones for KIAA1136 with hj01467. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 4789 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2952 bp
Genome contig ID	gi89161187f_25823148
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTATAACTTCTCTGCAATAAAACATATTTATATG
Flanking genome sequence (108015 - 108064)	----+--------+--------+--------+--------+----* AAAGTGATTTGTGGGGATTTGTGTGTTCATCTATAGAAAACTGAATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	25923144	25931161	3	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 596 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T848	1.9e-212	98.7	Probable G-prot...	Homo sapiens
AAS18315	4.2e-212	98.5	G protein coupl...	Homo sapiens
XP_521427	5.5e-212	98.3	hypothetical pr...	Pan troglodytes
XP_001101165	1.5e-202	94.4	G protein-coupl...	Macaca mulatta
EAW86110	1.7e-190	100.0	hCG24620 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AATCACTCAGAAATAGAACCG
Primer_r	TAAGAACAGCCCTATATCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp