KIAA1830

Product ID	ORK00928
Accession No	AB058733
Description	thioredoxin-related transmembrane protein 3
Clone name	hj01608
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4702 bp) Predicted protein sequence (486 aa)
HaloTag ORF Clone	FHC00928
Flexi ORF Clone	FXC00928
Source	Human adult brain
Rouge ID	mKIAA1830 by Kazusa Mouse cDNA Project

Length: 4702 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3240 bp
Genome contig ID	gi51511735r_64391908
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTTGTTTTTCTAAAATAAAGTAATTGAAAACCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAATTGTTTCTTATTTTTACTGTGTATCCTGGTTGTTTGCAATATGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	64491908	64533295	16	99.3	Perfect prediction

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JJ7	1.4e-193	100.0	Protein disulfi...	Homo sapiens
XP_001150102	3.5e-193	99.6	thioredoxin dom...	Pan troglodytes
Q5R875	1.6e-192	99.1	Protein disulfi...	Pongo abelii
XP_001493036	2.4e-180	92.7	thioredoxin dom...	Equus caballus
XP_001063895	1.2e-179	87.2	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011145	2e-06	20.7	KIAA0573
AB023179	5e-05	22.2	KIAA0962

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	76	84	PR00421	Thioredoxin-related
	IPR006662	84	93	PR00421	Thioredoxin-related
	IPR006662	127	138	PR00421	Thioredoxin-related
HMMPfam	IPR013766	58	161	PF00085	Thioredoxin domain
ScanRegExp	IPR006662	77	95	PS00194	Thioredoxin-related

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	40	TALRLCATVVVLDMVVCKGFVED	62	PRIMARY	23

Primer_f	GAGCAGGTGAATTAGCAGTAC
Primer_r	AATGTCAAGCCTAATCCCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-