KIAA1192

Gene/Protein Characteristic Table for KIAA1192

Order Kazusa clone(s) from :

Product ID	ORK05525
Accession No	AB033018
Description	importin 9
Clone name	hj01820a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1490 bp) Predicted protein sequence (262 aa)
Source	Human adult brain
Rouge ID	mKIAA1192 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 1490 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	700 bp
Genome contig ID	gi89161185f_200006537
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCAGACAGATGGCAATTTGATCTTCCTTTTTTAG
Flanking genome sequence (105970 - 106019)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGGGGAAAAGGGATTTTTTTTAAATCCACCTGACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	200106537	200112505	7	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 262 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD38991	3e-104	100.0	hypothetical pr...	Homo sapiens
BAA91588	3.2e-104	100.0	unnamed protein...	Homo sapiens
AAH03604	4.3e-104	100.0	IPO9 protein [H...	Homo sapiens
EAW91375	6.2e-104	100.0	importin 9, iso...	Homo sapiens
Q96P70	6.4e-104	100.0	Importin-9; Sho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGCCGTCACTTAGGAATGCTG
Primer_r	CAATAATGTTTCTGGACTCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp