Gene/Protein Characteristic Table for KIAA0589
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00103
Accession No AB011161
Description phosphatidylinositol-4-phosphate 5-kinase, type I, gamma, transcript variant 2
Clone name hj02695
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5047 bp)
Predicted protein sequence (687 aa)
Flexi ORF Clone FXC00103
Source Human adult brain
Rouge ID mKIAA0589 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 687 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60331 0 100.0 Phosphatidylino...
Homo sapiens
EAW69296 0 100.0 phosphatidylino...
Homo sapiens
XP_512274 0 96.5 phosphatidylino...
Pan troglodytes
BAH14283 0 99.8 unnamed protein...
Homo sapiens
BAG62861 0 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002498 176 462 PF01504 Phosphatidylinositol-4-phosphate 5-kinase
HMMSmart IPR002498 122 463 SM00330 Phosphatidylinositol-4-phosphate 5-kinase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGAAACTGCAAACCTCGTGTG
Primer_r GTCTCGGCGCTTTGGATTGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f TGAAACTGCAAACCTCGTGTG
Primer_r GTCTCGGCGCTTTGGATTGTC
PCR product length 97 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp