KIAA0593

Product ID	ORK05955
Accession No	AB011165
Description	mediator complex subunit 13
Clone name	hj02824s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8099 bp) Predicted protein sequence (2005 aa)
Source	Human adult brain
Rouge ID	mKIAA0593 by Kazusa Mouse cDNA Project
Note	We replaced hj02824, former representative clones for KIAA0593 with hj02824s1. (2003/8/28)

Length: 8099 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2079 bp
Genome contig ID	gi51511734r_57276532
PolyA signal sequence (None)	+--------+--------+----*----+---- CATTATGTTGGTATGTTTTGTTCTGTACTTTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACTTGTCTGAGATTTGAAGGAAAATGTGCTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	57376532	57467716	27	99.7	Perfect prediction

Length: 2005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UHV7	100.0	Mediator of RNA...	Homo sapiens
EAW51438	100.0	thyroid hormone...	Homo sapiens
XP_001138050	99.7	mediator of RNA...	Pan troglodytes
AAD22032	99.7	thyroid hormone...	Homo sapiens
XP_001110128	98.9	mediator of RNA...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028948	1.3e-131	51.9	KIAA1025

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009401	1096	1700	PF06333	TRAP240

Primer_f	ACAGCTCAGATTAAGGTAGGG
Primer_r	AGTCAGCAATGCAGGTAGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ACAGCTCAGATTAAGGTAGGG
Primer_r	AGTCAGCAATGCAGGTAGGAG
PCR product length	229 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles