Gene/Protein Characteristic Table for KIAA1927
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01185
Accession No AB067514
Description sperm specific antigen 2, transcript variant 1
Clone name hj03131
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5167 bp)
Predicted protein sequence (1325 aa)
Flexi ORF Clone FXC01185
Source Human adult brain
Rouge ID mKIAA1927 by Kazusa Mouse cDNA Project
Note We replaced ah01387, former representative clones for KIAA1927 with hj03131. (2003/8/28)
Features of the cloned cDNA sequence
Description

Length: 5167 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1188 bp
Genome contig ID gi89161199f_182364915
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATATATTAAAACAATAAAGTATTTATTTTGCCT
Flanking genome sequence
(138794 - 138843)
----+----*----+----*----+----*----+----*----+----*
AAAGTGTTTTAGTGGTTTCTTAAACTGCAACATGAAGATTTTGAATTAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 f 182464840 182503707 18 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 1325 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11373 0 100.0 sperm-specific ...
synthetic construct
P28290 0 99.9 Sperm-specific ...
Homo sapiens
AAH28706 0 99.8 Sperm specific ...
Homo sapiens
XP_001101290 0 96.5 similar to sper...
Macaca mulatta
BAC05027 0 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018291 3.4e-09 30.6 KIAA0748
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 1059 1325 PD120214 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCAAGTCAGCATTCCGATAGC
Primer_r TAACTGTTGTCTCACTGTCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp