KIAA0599

Product ID	ORK06397
Accession No	AB011171
Description	pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Clone name	hj03137
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5282 bp) Predicted protein sequence (697 aa)
Source	Human adult brain
Rouge ID	mKIAA0599 by Kazusa Mouse cDNA Project

Length: 5282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3188 bp
Genome contig ID	gi51511730f_64177555
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTGTCAAAAGACTGTAGAGTAGAATAAGGAGAG
Flanking genome sequence (105810 - 105859)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGACCTTGCTAGGGCACTGGGAGAGCTTAGCCCTGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	64277555	64283363	2	99.3	Perfect prediction

Length: 697 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH73907	100.0	PLEKHG3 protein...	Homo sapiens
BAB84995	100.0	FLJ00242 protei...	Homo sapiens
NP_056364	100.0	pleckstrin homo...	Homo sapiens
A1L390	100.0	Pleckstrin homo...	Homo sapiens
AAI29953	99.9	PLEKHG3 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCCCACAGCCAGAGTCAGTTG
Primer_r	TGACAGTATTCCCAAACGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TCCCACAGCCAGAGTCAGTTG
Primer_r	TGACAGTATTCCCAAACGAGG
PCR product length	165 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles