Order Kazusa clone(s) from : ![]() |
Product ID | ORK00589 |
---|---|
Accession No | AB014546 |
Description | ring finger protein 8, E3 ubiquitin protein ligase, transcript variant 1 |
Clone name | hj03808 |
Vector information | |
cDNA sequence | DNA sequence (5545 bp) Predicted protein sequence (486 aa) |
HaloTag ORF Clone |
FHC00589
![]() |
Flexi ORF Clone | FXC00589 |
Source | Human adult brain |
Rouge ID |
mKIAA0646
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3975 bp |
---|---|
Genome contig ID | gi89161210f_37329807 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (140682 - 140731) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 37429807 | 37470487 | 8 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000253 | 39 | 110 | PF00498 | Forkhead-associated |
IPR001841 | 404 | 441 | PF00097 | Zinc finger | |
HMMSmart | IPR000253 | 38 | 93 | SM00240 | Forkhead-associated |
IPR001841 | 404 | 441 | SM00184 | Zinc finger | |
ProfileScan | IPR000253 | 39 | 93 | PS50006 | Forkhead-associated |
IPR001841 | 404 | 442 | PS50089 | Zinc finger | |
ScanRegExp | IPR001841 | 419 | 428 | PS00518 | Zinc finger |
![]() |
---|
![]() |
Primer_f | TCCCCAAACAATGTACCAGTG |
---|---|
Primer_r | AGTGGACAGCAGAGATAGTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCCCAAACAATGTACCAGTG |
Primer_r | AGTGGACAGCAGAGATAGTGG |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |