KIAA0646

Product ID	ORK00589
Accession No	AB014546
Description	ring finger protein 8, E3 ubiquitin protein ligase, transcript variant 1
Clone name	hj03808
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5545 bp) Predicted protein sequence (486 aa)
HaloTag ORF Clone	FHC00589
Flexi ORF Clone	FXC00589
Source	Human adult brain
Rouge ID	mKIAA0646 by Kazusa Mouse cDNA Project

Length: 5545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3975 bp
Genome contig ID	gi89161210f_37329807
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTCTGCATGTATTCAATAAATTCAATTCAGCAAT
Flanking genome sequence (140682 - 140731)	----+--------+--------+--------+--------+----* AGTTATCAAATGCCCATTTTCTTACTAGGCACTGCTCTAGGTGTTTGGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	37429807	37470487	8	100.0	Perfect prediction

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O76064	1.7e-152	100.0	E3 ubiquitin-pr...	Homo sapiens
AAP36421	1.7e-152	100.0	ring finger pro...	synthetic construct
BAD96485	4.2e-152	99.6	ring finger pro...	Homo sapiens
EAX03943	5.2e-152	99.6	ring finger pro...	Homo sapiens
BAE87261	3.1e-147	97.1	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	39	110	PF00498	Forkhead-associated
HMMPfam	IPR001841	404	441	PF00097	Zinc finger
HMMSmart	IPR000253	38	93	SM00240	Forkhead-associated
HMMSmart	IPR001841	404	441	SM00184	Zinc finger
ProfileScan	IPR000253	39	93	PS50006	Forkhead-associated
ProfileScan	IPR001841	404	442	PS50089	Zinc finger
ScanRegExp	IPR001841	419	428	PS00518	Zinc finger

Primer_f	TCCCCAAACAATGTACCAGTG
Primer_r	AGTGGACAGCAGAGATAGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCCCAAACAATGTACCAGTG
Primer_r	AGTGGACAGCAGAGATAGTGG
PCR product length	137 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles