Order Kazusa clone(s) from : ![]() |
Product ID | ORK00649 |
---|---|
Accession No | AB020639 |
Description | estrogen-related receptor gamma, transcript variant 1 |
Clone name | hj04617 |
Vector information | |
cDNA sequence | DNA sequence (5216 bp) Predicted protein sequence (469 aa) |
HaloTag ORF Clone |
FHC00649
![]() |
Flexi ORF Clone | FXC00649 |
Source | Human adult brain |
Rouge ID |
mKIAA0832
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3685 bp |
---|---|
Genome contig ID | gi89161185r_214643219 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 214743219 | 214963418 | 7 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001628 | 138 | 204 | PD000035 | Zinc finger |
FPrintScan | IPR001628 | 139 | 155 | PR00047 | Zinc finger |
IPR001628 | 155 | 170 | PR00047 | Zinc finger | |
IPR001628 | 188 | 196 | PR00047 | Zinc finger | |
IPR001628 | 196 | 204 | PR00047 | Zinc finger | |
IPR001723 | 200 | 210 | PR00398 | Steroid hormone receptor | |
IPR000003 | 210 | 224 | PR00545 | Retinoid X receptor | |
IPR000003 | 273 | 293 | PR00545 | Retinoid X receptor | |
IPR001723 | 282 | 303 | PR00398 | Steroid hormone receptor | |
IPR001723 | 303 | 319 | PR00398 | Steroid hormone receptor | |
IPR000003 | 317 | 334 | PR00545 | Retinoid X receptor | |
IPR000003 | 356 | 376 | PR00545 | Retinoid X receptor | |
IPR001723 | 370 | 385 | PR00398 | Steroid hormone receptor | |
IPR000003 | 396 | 413 | PR00545 | Retinoid X receptor | |
IPR000003 | 417 | 436 | PR00545 | Retinoid X receptor | |
IPR001723 | 427 | 444 | PR00398 | Steroid hormone receptor | |
IPR000003 | 444 | 463 | PR00545 | Retinoid X receptor | |
HMMPfam | IPR001628 | 137 | 212 | PF00105 | Zinc finger |
IPR000536 | 284 | 464 | PF00104 | Nuclear hormone receptor | |
HMMSmart | IPR001628 | 136 | 207 | SM00399 | Zinc finger |
IPR000536 | 281 | 439 | SM00430 | Nuclear hormone receptor | |
ProfileScan | IPR001628 | 136 | 211 | PS51030 | Zinc finger |
ScanRegExp | IPR001628 | 139 | 165 | PS00031 | Zinc finger |
![]() |
Primer_f | AAGAGAAAATGGGTGTTGGTG |
---|---|
Primer_r | CTACTGGCTATAATGCAACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |