KIAA0948

Gene/Protein Characteristic Table for KIAA0948

Order Kazusa clone(s) from :

Product ID	ORK00693
Accession No	AB023165
Description	transforming growth factor beta regulator 4, transcript variant 2
Clone name	hj05004
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4432 bp) Predicted protein sequence (531 aa)
HaloTag ORF Clone	FHC00693
Flexi ORF Clone	FXC00693
Source	Human adult brain
Rouge ID	mKIAA0948 by Kazusa Mouse cDNA Project

Length: 4432 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Features of the protein sequence

Description

Length: 531 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAL23745	3.2e-214	100.0	transforming gr...	Homo sapiens
BAD96663	6.8e-214	99.8	cell cycle prog...	Homo sapiens
XP_001150463	9.2e-214	99.6	cell cycle prog...	Pan troglodytes
BAG50885	3.2e-202	100.0	unnamed protein...	Homo sapiens
XP_001086878	5.7e-196	91.4	similar to cell...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	269	339	PF06743	FAST kinase leucine-rich
	IPR013579	349	436	PF08368	FAST kinase-like protein
	IPR013584	463	520	PF08373	RAP domain

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ACAGAACAGAGAGTAGGACAG
Primer_r	TGGCCAAGCATCAGAGCAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp