KIAA1065

Product ID	ORK02016
Accession No	AB028988
Description	epsin 2, transcript variant 2
Clone name	hj05094
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4799 bp) Predicted protein sequence (665 aa)
HaloTag ORF Clone	FHC02016
Flexi ORF Clone	FXC02016
Source	Human adult brain
Rouge ID	mKIAA1065 by Kazusa Mouse cDNA Project

Length: 4799 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2460 bp
Genome contig ID	gi51511734f_18855279
PolyA signal sequence (TATAAA,-29)	+--------+--------+----*----+---- TTACTGTATAAATATAATTTATCATTTGTACCATG
Flanking genome sequence (325343 - 325392)	----+--------+--------+--------+--------+----* ATGCGGTTTCTGGCTGTGTCCTTCTCCCACCCCATCTTCATCAGTCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	19081318	19180620	11	99.4	Perfect prediction

Length: 665 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW50875	6.8e-203	100.0	epsin 2, isofor...	Homo sapiens
O95208	1.2e-202	99.8	Epsin-2; EPS-15...	Homo sapiens
XP_001154310	2.4e-202	99.7	epsin 2 isoform...	Pan troglodytes
XP_001154203	9.5e-202	99.5	epsin 2 isoform...	Pan troglodytes
AAC78609	1.9e-201	99.5	epsin 2b [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79993	1.5e-11	27.6	KIAA0171

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001026	41	164	PF01417	Epsin
HMMPfam	IPR003903	298	315	PF02809	Ubiquitin interacting motif
HMMSmart	IPR013809	42	168	SM00273	Epsin-like
	IPR003903	299	318	SM00726	Ubiquitin interacting motif
	IPR003903	324	343	SM00726	Ubiquitin interacting motif
ProfileScan	IPR013809	36	168	PS50942	Epsin-like
	IPR003903	299	318	PS50330	Ubiquitin interacting motif
	IPR003903	324	343	PS50330	Ubiquitin interacting motif

Primer_f	AGTTCCTGACCAGCCACCTTC
Primer_r	ATCCTGCCTCCCATCCCATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGTTCCTGACCAGCCACCTTC
Primer_r	ATCCTGCCTCCCATCCCATTG
PCR product length	140 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles