KIAA1068

Gene/Protein Characteristic Table for KIAA1068

Order Kazusa clone(s) from :

Product ID	ORK06202
Accession No	AB028991
Description	NudC domain containing 3
Clone name	hj05437
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4793 bp) Predicted protein sequence (354 aa)
Source	Human adult brain
Rouge ID	mKIAA1068 by Kazusa Mouse cDNA Project

Length: 4793 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3727 bp
Genome contig ID	gi89161213r_44288408
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAGGGTTGTTACATGGGTAAATTGGATCATAGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTTGGTGTACAGATAATTTTGTCACCCAGGTAATCAGCATGATACCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	44388408	44496704	6	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IVD9	1.7e-128	100.0	NudC domain-con...	Homo sapiens
AAH35014	1.2e-127	99.4	NudC domain con...	Homo sapiens
Q5RB75	8e-127	98.9	NudC domain-con...	Pongo abelii
XP_001092225	6.8e-126	98.0	NudC domain con...	Macaca mulatta
EDM00334	1.1e-115	89.4	rCG35703, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007052	181	260	PF04969	CS
ProfileScan	IPR007052	178	270	PS51203	CS

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GAACAGGCATTTAAACCAGGC
Primer_r	TAGTGTGAGCTGGGTGAGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAACAGGCATTTAAACCAGGC
Primer_r	TAGTGTGAGCTGGGTGAGTAG
PCR product length	193 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp