KIAA0953

Gene/Protein Characteristic Table for KIAA0953

Order Kazusa clone(s) from :

Product ID	ORK00157
Accession No	AB023170
Description	EFR3 homolog B (S. cerevisiae)
Clone name	hj05484
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5161 bp) Predicted protein sequence (789 aa)
HaloTag ORF Clone	FHC00157
Flexi ORF Clone	FXC00157
Source	Human adult brain
Rouge ID	mKIAA0953 by Kazusa Mouse cDNA Project

Length: 5161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2791 bp
Genome contig ID	gi89161199f_25018598
PolyA signal sequence (ACTAAA,-33)	+--------+--------+----*----+---- TTACTAAAACTACAAAAAATTAGCCGGGCATGGTG
Flanking genome sequence (205665 - 205714)	----+--------+--------+--------+--------+----* GCGGCCACCTGTAACTCAGCTACTGGGGAGGCTGAGGCAGGAGAATCACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	25118503	25224261	19	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 789 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2G0	100.0	Protein EFR3 ho...	Homo sapiens
XP_001066858	97.8	similar to RIKE...	Rattus norvegicus
XP_233942	92.2	similar to RIKE...	Rattus norvegicus
Q6ZQ18	97.5	Protein EFR3 ho...	Mus musculus
XP_532893	97.9	similar to RIKE...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63477	7.8e-118	60.0	KIAA0143

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GGTGAATATCCAATGTTGCTC
Primer_r	GCTATGCTCGGCTTTAACTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGTGAATATCCAATGTTGCTC
Primer_r	GCTATGCTCGGCTTTAACTCG
PCR product length	93 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp