KIAA1872

Product ID	ORK00938
Accession No	AB058775
Description	ataxia, cerebellar, Cayman type
Clone name	hj05518
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4976 bp) Predicted protein sequence (434 aa)
HaloTag ORF Clone	FHC00938
Flexi ORF Clone	FXC00938
Source	Human adult brain
Rouge ID	mKIAA1872 by Kazusa Mouse cDNA Project

Length: 4976 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3484 bp
Genome contig ID	gi42406306f_3731672
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGGGACTTTTATGTGGAATAAAGAAACTATCACTG
Flanking genome sequence (147406 - 147455)	----+--------+--------+--------+--------+----* AGAAGGGAGGTTTGTTCCTTTTGAGTACTAGTAACAGGCAGGGCCCAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	3831672	3879076	13	99.3	Perfect prediction

Length: 434 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86WG3	4.6e-154	100.0	Caytaxin; Ataxi...	Homo sapiens
AAO63019	2.1e-153	99.7	BNIP-H [Homo sa...	Homo sapiens
CAH90150	1.7e-152	98.9	hypothetical pr...	Pongo abelii
Q9GKT0	5.8e-152	98.4	Caytaxin.	Macaca fascicularis
AAI33610	1.9e-145	94.6	ATCAY protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002365	1.3e-52	61.6	KIAA0367

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001251	234	388	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	234	391	PS50191	Cellular retinaldehyde-binding/triple function

Primer_f	ATAGACCTGCACATGATCCGG
Primer_r	TCTAAGCTGCTGATGACGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGAAACTGAAGACCCCAACTC
Primer_r	ATCCATCTCAAAGCCCATCTG
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec161 cycles