KIAA1622

Product ID	ORK00257
Accession No	AB046842
Description	protein phosphatase 4, regulatory subunit 4, transcript variant 1
Clone name	hj06359b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (3786 bp) Predicted protein sequence (892 aa)
HaloTag ORF Clone	FHC00257
Flexi ORF Clone	FXC00257
Source	Human adult brain
Rouge ID	mKIAA1622 by Kazusa Mouse cDNA Project

Length: 3786 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1091 bp
Genome contig ID	gi51511730f_93610483
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GAATTTACTCAAAATAAAACATAGGTTAATGAGAT
Flanking genome sequence (205344 - 205393)	----+--------+--------+--------+--------+----* ACCTGTGTTTGTGAAAAAAAGTCTTAAATACTTTCCTGCAGTTTTTATTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	93710483	93815825	25	99.7	Perfect prediction

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_522937	99.8	HEAT-like repea...	Pan troglodytes
EDL18824	89.9	RIKEN cDNA 8430...	Mus musculus
Q8C0Y0	90.7	Serine/threonin...	Mus musculus
AAI11888	90.9	RIKEN cDNA 8430...	Mus musculus
XP_547959	95.9	similar to HEAT...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	226	262	PF02985	HEAT
	IPR000357	265	301	PF02985	HEAT
	IPR000357	411	446	PF02985	HEAT
ProfileScan	IPR000357	232	269	PS50077	HEAT
ProfileScan	IPR000357	271	309	PS50077	HEAT

Primer_f	GAATTTTCACTCCAGATCAGC
Primer_r	CATGGCCGGAAAGTTATAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-