KIAA1072

Product ID	ORK00730
Accession No	AB028995
Description	protein phosphatase, Mg2+/Mn2+ dependent, 1E, transcript variant 1
Clone name	hj06360
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5035 bp) Predicted protein sequence (759 aa)
HaloTag ORF Clone	FHC00730
Flexi ORF Clone	FXC00730
Source	Human adult brain
Rouge ID	mKIAA1072 by Kazusa Mouse cDNA Project

Length: 5035 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2634 bp
Genome contig ID	gi51511734f_54088231
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TCTATATAATATCTATAAACTGTTAATGCTGAGGT
Flanking genome sequence (327579 - 327628)	----+--------+--------+--------+--------+----* ATAGTCTGTGAATTATGTGTTTTGTATTTTTATTCATTGTGTAATTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	54188231	54415808	7	99.0	Perfect prediction

Length: 759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM76058	100.0	partner of PIX ...	Homo sapiens
NP_055721	99.7	protein phospha...	Homo sapiens
XP_853253	91.0	similar to prot...	Canis lupus fam...
Q8WY54	98.7	Protein phospha...	Homo sapiens
Q80TL0	89.3	Protein phospha...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13640	1.7e-28	47.1	KIAA0015

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	234	485	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	223	490	SM00332	Protein phosphatase 2C-related
ScanRegExp	IPR000222	272	280	PS01032	Protein phosphatase 2C

Primer_f	ACACATGCTAGGCTTTCTCAG
Primer_r	TAACGACCACACTAGAACTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-