KIAA1267

Product ID	ORK00790
Accession No	AB033093
Description	KAT8 regulatory NSL complex subunit 1, transcript variant 2
Clone name	hj06438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4730 bp) Predicted protein sequence (1105 aa)
HaloTag ORF Clone	FHC00790
Flexi ORF Clone	FXC00790
Source	Human adult brain
Rouge ID	mKIAA1267 by Kazusa Mouse cDNA Project

Length: 4730 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1318 bp
Genome contig ID	gi51511734r_41363371
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGGTTGAAAATTCTGAATAACCCTTTTAGCATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAACAAAAACAAAAAATGGAAAAAAAAAACCTTGTATTTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	41463371	41605382	14	99.7	Perfect prediction

Length: 1105 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF83948	99.9	unnamed protein...	Homo sapiens
CAL37692	99.8	hypothetical pr...	synthetic construct
CAL38562	99.8	hypothetical pr...	synthetic construct
XP_511576	99.5	hypothetical pr...	Pan troglodytes
XP_001115905	99.0	similar to CG46...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ATCCCTGTCGGTGTTAGTTCC
Primer_r	ACAGGCACAAGGTTAACAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 17

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ATCCCTGTCGGTGTTAGTTCC
Primer_r	ACAGGCACAAGGTTAACAGAG
PCR product length	124 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles