KIAA0837

Product ID	ORK01127
Accession No	AB020644
Description	acyl-CoA synthetase long-chain family member 6, transcript variant 2
Clone name	hj06536
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4868 bp) Predicted protein sequence (745 aa)
HaloTag ORF Clone	FHC01127
Flexi ORF Clone	FXC01127
Source	Human adult brain
Rouge ID	mKIAA0837 by Kazusa Mouse cDNA Project

Length: 4868 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2630 bp
Genome contig ID	gi51511721r_131215479
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAACGAGACTCCGTCTC
Flanking genome sequence (99717 - 99668)	----+--------+--------+--------+--------+----* AAAAAGAAAGAAAAAAAAAAAACAAAAACAAGGTTTCTTCTTTTTGCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	131315196	131375214	21	99.4	Perfect prediction

Length: 745 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11245	100.0	acyl-CoA synthe...	synthetic construct
NP_056071	98.5	acyl-CoA synthe...	Homo sapiens
Q9UKU0	100.0	Long-chain-fatt...	Homo sapiens
BAE02116	99.1	unnamed protein...	Macaca fascicularis
EAW62358	98.4	acyl-CoA synthe...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014531	1.5e-30	26.3	KIAA0631

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000873	316	327	PR00154	AMP-dependent synthetase and ligase
FPrintScan	IPR000873	328	336	PR00154	AMP-dependent synthetase and ligase
HMMPfam	IPR000873	170	438	PF00501	AMP-dependent synthetase and ligase
HMMPfam	IPR000873	476	636	PF00501	AMP-dependent synthetase and ligase
ScanRegExp	IPR000873	321	332	PS00455	AMP-dependent synthetase and ligase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	22	TAMLTFFLVSGGSLWLFVEFVLS	44	PRIMARY	23
SOSUI2	2	73	LSATTLVSMGALAAILAYWFTHR	95	PRIMARY	23

Primer_f	TTTCCCATTGTCCTCCTACTC
Primer_r	TCTCCTGACCTCGTGATCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-