Order Kazusa clone(s) from : ![]() |
Product ID | ORK00732 |
---|---|
Accession No | AB028998 |
Description | tensin 2, transcript variant 2 |
Clone name | hj06716s1 |
Vector information | |
cDNA sequence | DNA sequence (5009 bp) Predicted protein sequence (1505 aa) |
HaloTag ORF Clone |
FHC00732
![]() |
Flexi ORF Clone | FXC00732 |
Source | Human adult brain |
Rouge ID |
mKIAA1075
by Kazusa Mouse cDNA Project
|
Note | We replaced hj06716, former representative clones for KIAA1075 with hj06716s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 489 bp |
---|---|
Genome contig ID | gi89161190f_51629947 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114477 - 114526) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 51729947 | 51744422 | 29 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000980 | 1236 | 1340 | PD000093 | SH2 motif |
HMMPfam | IPR002219 | 128 | 178 | PF00130 | Protein kinase C |
IPR000980 | 1236 | 1328 | PF00017 | SH2 motif | |
IPR013625 | 1371 | 1504 | PF08416 | Tensin phosphotyrosine-binding domain | |
HMMSmart | IPR002219 | 128 | 175 | SM00109 | Protein kinase C |
IPR000980 | 1234 | 1334 | SM00252 | SH2 motif | |
IPR006020 | 1367 | 1505 | SM00462 | Phosphotyrosine interaction region | |
ProfileScan | IPR002219 | 127 | 175 | PS50081 | Protein kinase C |
IPR014019 | 218 | 390 | PS51181 | Phosphatase tensin type | |
IPR014020 | 395 | 521 | PS51182 | C2 tensin-type | |
IPR000980 | 1236 | 1347 | PS50001 | SH2 motif | |
ScanRegExp | IPR002219 | 128 | 175 | PS00479 | Protein kinase C |
![]() |
Primer_f | TCCTACTCTGAATCTCTGCTC |
---|---|
Primer_r | AGTTGAGCCCCGAAGGAGATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGTTGAGCCCCGAAGGAGATC |
Primer_r | TCCTACTCTGAATCTCTGCTC |
PCR product length | 167 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |