KIAA1077

Product ID	ORK07023
Accession No	AB029000
Description	sulfatase 1
Clone name	hj06803
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4834 bp) Predicted protein sequence (818 aa)
Source	Human adult brain
Rouge ID	mKIAA1077 by Kazusa Mouse cDNA Project

Length: 4834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2377 bp
Genome contig ID	gi51511724f_70550758
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCAATATTTCTTCAAATAAAAGGTGTTTAAACTTT
Flanking genome sequence (184945 - 184994)	----+--------+--------+--------+--------+----* TTTCTGTTTCAGAGAAATGAACTTAACCAAGTTTTTGTGGTACACCCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	70650758	70735701	18	100.0	Terminal No-hit

Length: 818 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IWU6	100.0	Extracellular s...	Homo sapiens
AAO33315	100.0	sulfatase SULF1...	Homo sapiens
CAE11871	99.9	hypothetical pr...	Homo sapiens
EAW86954	99.0	sulfatase 1, is...	Homo sapiens
NP_001041580	94.5	sulfatase 1 [Ca...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033073	1.3e-115	65.8	KIAA1247

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000917	20	759	PF00884	Sulphatase
ScanRegExp	IPR000917	32	44	PS00523	Sulphatase

Primer_f	GCTCCACAATTTCAACATACC
Primer_r	GAATAGGAGGGTACTGATGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-