KIAA0981

Product ID	ORK06366
Accession No	AB023198
Description	phosphoinositide kinase, FYVE finger containing
Clone name	hj07094
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5182 bp) Predicted protein sequence (578 aa)
Source	Human adult brain
Rouge ID	mKIAA0981 by Kazusa Mouse cDNA Project

Length: 5182 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3444 bp
Genome contig ID	gi89161199f_208809846
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAAAGAAATCTTAACAATAAACTCAGAATCTACTT
Flanking genome sequence (121870 - 121919)	----+--------+--------+--------+--------+----* ACTCCACTTAGTTTTGAATCTGCTTGAAGAAATTGACAACAAAAGGAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	208909846	208931714	15	99.2	Perfect prediction

Length: 578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70449	100.0	phosphatidylino...	Homo sapiens
EAW70444	100.0	phosphatidylino...	Homo sapiens
AAI56452	100.0	Phosphatidylino...	synthetic construct
Q9Y2I7	100.0	FYVE finger-con...	Homo sapiens
BAC03674	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002498	327	564	PF01504	Phosphatidylinositol-4-phosphate 5-kinase
HMMSmart	IPR002498	271	565	SM00330	Phosphatidylinositol-4-phosphate 5-kinase

Primer_f	AGCTTTTGTGATGGCATTGTG
Primer_r	ACTTGAGGAATAATGAATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-