KIAA0984

Product ID	ORK05629
Accession No	AB023201
Description	TBC1 domain family, member 30
Clone name	hj07670
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4701 bp) Predicted protein sequence (728 aa)
HaloTag ORF Clone	FHC05629
Flexi ORF Clone	FXC05629
Source	Human adult brain
Rouge ID	mKIAA0984 by Kazusa Mouse cDNA Project

Length: 4701 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2512 bp
Genome contig ID	gi89161190f_63407878
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TAGAAAATAAAGAAACCTGCAGTAGCCTCTACCAC
Flanking genome sequence (150474 - 150523)	----+--------+--------+--------+--------+----* ACAGCATGTACAAAGACCAGTATGGACTTGCTATCTTCCCTATGTATTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	63466058	63558350	13	99.3	Perfect prediction

Length: 728 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAH16657	98.2	TBC1 domain fam...	Homo sapiens
EAW97144	99.8	hCG2014677, iso...	Homo sapiens
Q69ZT9	89.2	TBC1 domain fam...	Mus musculus
BAC31963	89.1	unnamed protein...	Mus musculus
CAH92459	89.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028978	2.7e-06	28.5	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	50	283	PF00566	RabGAP/TBC
HMMSmart	IPR000195	50	284	SM00164	RabGAP/TBC
ProfileScan	IPR000195	53	261	PS50086	RabGAP/TBC

Primer_f	CCTTGAGGGATGTCTGACTTG
Primer_r	GATACTAAGTTTGTGGACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-